Is Blueberries Good For Liver Disease

Is Blueberries Good For Liver Disease
Edward R. Forte October 23, 2021

Blueberries

Is Blueberries Good For Liver Disease

This article will cover the best foods for liver health, including their beneficial effects on the organ, and some foods to avoid.Although it may be impossible to manage all risk factors, consuming certain foods and drinks may help promote liver health.There are many foods and drinks that a person can consume to help protect the liver.Coffee appears to be good for the liver, especially because it protects against issues such as fatty liver disease.A 2014 study suggests that the protective effects of coffee may be due to how it influences liver enzymes.Coffee, it reports, seems to reduce fat buildup in the liver.Oats and oatmeal are high in compounds called beta-glucans.The review also notes that beta-glucans from oats appear to help reduce the amount of fat stored in the liver in mice, which could also help protect the liver.It is important to note that drinking green tea may be better for health than taking a green tea extract, as high dose extracts may damage the liver rather than heal it.A small 2016 study suggests that supplementing the diet with garlic powder capsules can reduce body weight and body fat in people with nonalcoholic fatty liver disease (NAFLD), with no loss of lean body mass.More studies in humans are necessary to determine whether or not eating garlic would have the same effect.Many dark berries — including blueberries, raspberries, and cranberries — contain antioxidants called polyphenols, which may help protect the liver from damage.These antioxidants seem to be associated with protection from some causes of liver damage.Eating whole, seeded grapes is a simple way to add these compounds to the diet.A 2019 study suggests that naringin may protect against alcohol-induced liver steatosis by reducing oxidative stress.The fruit and juice of the prickly pear may also be beneficial to liver health.Eating nuts may be another simple way to keep the liver healthy and protect against NAFLD.Eating too much fat is not good for the liver, but some fats may help it.Replacing less healthy fats with olive oil may help reduce oxidative stress and improve liver function . .

7 Foods to Protect Your Liver

Top Foods for Liver Health.Here are the top 7 liver-cleansing foods and supplements to help support a well-functioning liver.Quarter baby artichokes, grill until tender, then toss with a dressing of minced shallots, grapefruit juice and olive oil.Some research indicates that green tea may also reduce the risk of liver cancer.Most importantly, because some studies suggest concentrated green tea supplements can increase the risk of liver damage, it’s best to drink it in its natural form – as a leaf or powder made into tea.Combine matcha green tea powder with minced garlic, ginger, sesame oil and rice vinegar for a robust Asian dressing.For example, in one study, men with fatty liver disease who took broccoli sprout extract as a liver detox food showed improved liver enzyme levels and decreased oxidative stress.Combine chopped grapefruit sections with minced red pepper, red onions, jalapeño peppers, cilantro and lime juice for a zesty salsa.Blueberries are rich in anthocyanins, antioxidants that reduce inflammation and protect the liver from oxidative stress.Some studies suggest blueberries, as well as cranberries, protect against liver damage and reduce the risk of fibrosis.Beetroot juice has traditionally been used as a remedy to activate liver enzymes and increase bile, which helps the liver’s detox function.Coffee protects against fatty liver disease and reduces inflammation.Studies show drinking coffee lowers the risk of cirrhosis, a condition that’s marked by scarring of the liver, even in people with chronic liver disease.Simmer coconut milk with ginger, turmeric and honey, strain and add to brewed coffee.Top Supplements for Liver Health.It’s rich in compounds with antioxidant and anti-inflammatory activities, and studies show it can protect the liver from damage caused by toxins, acetaminophen and chronic alcohol consumption.Similarly, other research shows betaine can protect the liver from inflammation and damage caused by toxins and chronic alcohol consumption.The active compound found in turmeric, protects against inflammation and free-radical damage and is widely used in Ayurvedic medicine.For example, studies show that curcumin can protect the liver from damage caused by toxins, chronic alcohol intake and a high-fat diet. .

11 Foods That Are Good for Your Liver

Studies have shown that drinking coffee protects the liver from disease, even among those who already have problems with this organ.For example, studies have repeatedly shown that drinking coffee helps lower the risk of cirrhosis, or permanent liver damage, in people with chronic liver disease ( 1 , 2 , 3 ).Drinking coffee may also help reduce the risk of developing a common type of liver cancer, and it has positive effects on liver disease and inflammation ( 1 , 2 , 3 ).It also helps lower the risk of developing liver disease, cancer, and fatty liver.A smaller study including people with nonalcoholic fatty liver disease (NAFLD) found that drinking green tea high in antioxidants for 12 weeks improved liver enzyme levels and may also help reduce oxidative stress and fat deposits in the liver ( 7 ).For example, one study in mice found that black tea extract reversed many of the negative effects of a high fat diet on the liver, as well as improved blood markers of liver health ( 11 ).Moreover, in mice that were fed a high fat diet, naringenin decreased the amount of fat in the liver and increased the number of enzymes necessary to burn fat, which can help prevent excess fat from accumulating ( 13 ).However, human studies, as well as those on grapefruit or grapefruit juice itself, are lacking.Several animal studies have demonstrated that whole cranberries and blueberries, as well as their extracts or juices, can help keep the liver healthy ( 16 , 17 ).Summary Berries are high in antioxidants, which help protect the liver from damage.Studies have found that they can have various benefits, including lowering inflammation, preventing damage, and increasing antioxidant levels ( 20 , 21 ).Summary Animal and some human studies show that grapes and grapeseed extract protect the liver from damage, increase antioxidant levels, and fight inflammation.A more recent study in rats sought to determine the effectiveness of prickly pear juice, rather than its extract, at combating the negative effects of alcohol.More human studies are needed, especially using prickly pear fruit and juice, rather than extract.You can juice beets yourself or buy beetroot juice from the store or online.Several rat studies have shown that beetroot juice helps reduce oxidative damage and inflammation in the liver, as well as increase natural detoxification enzymes ( 26 , 27, 28 , 29 ).Other beneficial health effects of beetroot juice have been observed in animal studies and replicated in human studies.However, more studies are needed to confirm the benefits of beetroot juice on liver health in humans.Summary Beetroot juice helps protect the liver from oxidative damage and inflammation, all while increasing its natural detoxification enzymes.Animal studies have shown Brussels sprouts and broccoli sprout extract help increase levels of detoxification enzymes and protect the liver from damage ( 30 , 31 ).Summary Cruciferous vegetables like broccoli and Brussels sprouts may help increase the liver’s natural detoxification enzymes, protect it from damage, and improve blood levels of liver enzymes.While more high quality studies are needed, preliminary data points to nuts being an important food group for liver health.Summary Nut intake has been associated with improved liver enzyme levels in people with NAFLD.The ratio of omega-3 fats to omega-6 fats is also important.Olive oil Olive oil is considered a healthy fat because of its many health benefits, including positive effects on heart and metabolic health.One small study including 11 people with NAFLD found that consuming 1 teaspoon (6.5 mL) of olive oil per day improved liver enzyme and fat levels.Several more recent studies have found similar effects of olive oil consumption in humans, including less fat accumulation in the liver, improved insulin sensitivity, and improved blood levels of liver enzymes ( 39 , 40 ).Summary Studies show that olive oil consumption helps decrease the levels of fat in the liver, increase blood flow, and improve liver enzyme levels. .

Blueberry, combined with probiotics, alleviates non-alcoholic fatty

Juanjuan Zhu , Mingyu Zhou , Xueke Zhao , Mao Mu and Mingliang Cheng *.Blueberry, combined with probiotics (BP), might be a potential candidate for NAFLD treatment, due to its anti-inflammatory and anti-apoptotic properties.Here, we investigated whether the anti-inflammatory cytokine, IL-22, was involved in the therapeutic process of BP, using cell and rat models of NAFLD.Results indicated that BP significantly reduced lipid droplets and triglyceride (TG) accumulation in NAFLD cells.We conclude that IL-22 is vital for the therapeutic effect of BP, and acts via activation of JAK1/STAT3 signaling and inhibition of the apoptosis factor BAX, which makes IL-22 a promising target for therapy of NAFLD.3 The pro-inflammatory cytokines can activate fat synthesis, which leads to the accumulation of triglycerides and cholesterol in liver cells, and results in NAFLD.As intestinal microecological regulators, probiotics can effectively reduce endotoxemia and improve the intestinal barrier function, and are thought to play a therapeutic role in the treatment of NAFLD.6,7 Additionally, blueberries are common fruits that are rich in trace elements, flavonoids, vitamins, and especially polyphenols, such as anthocyanins, which have anti-oxidative, anti-inflammatory and immune regulatory properties.Here, the therapeutic mechanism of BP in NAFLD was investigated by exploring the roles of IL-22, the JAK1/STAT3 signaling pathway, and the apoptotic regulator, Bcl-2-associated X protein (BAX).All the protocols in this study were approved by the animal care and ethical committee of Affiliated Hospital of Guizhou Medical University.Dry probiotic tablets mixed with probiotic species of Bifidobacterium infantis , Bifidobacterium animalis and Lactobacillus acidophilus were obtained from China General Microbiological Culture Collection Center (Beijing, China).After incubation for 6 h, 12 h, and 24 h, 0.01 ml of the blueberry probiotic mixture was taken and the total number of colonies was calculated directly under a microscope.11 Briefly, 1 kg blueberry blend was thawed at 4 °C for 8 h and crushed using a Braun Global Hand Blender MR300 (De'Longhi Kenwood A.P.A Ltd, Hong Kong, China).12 Table 1 shows the main chemical characterisation of blueberry juice and the anthocyanidin concentration was 0.98 ± 0.07 (mg mL).After incubation for 6 h, 12 h, and 24 h, 0.01 ml of the blueberry probiotic mixture was taken and the total number of colonies was calculated directly under a microscope.Male Wistar rats (weight: 180 ± 20 g) of clean grade were purchased from the Animal Experiment Center of Guizhou Medical University (SCXK – (Guizhou) 2012–2012), and kept in separate cages and allowed free feeding with the standard diet.The cell slides were washed with 60% isopropyl alcohol and stained with hematoxylin for 10 s, and observed under a microscope.Except for the normal group, rats were injected with lentivirus carrying siRNA (virus titer of 1 × 10 8 , at a time) on alternate days, for 12 weeks.Thereafter 3 rats from each group were randomly selected to confirm the NAFLD model and the siRNA effect, and BP groups were gavaged with BP (once a day, 1.5 mL per 100 g weight, containing probiotics at a concentration of 10 8 CFU mL −1 and an anthocyanin amount of 1.47 mg per 100 g weight, per time) for 8 weeks.The intracellular plasma triglyceride (TG) was tested using a biochemical analyzer (Beijing Jinji Aomeng Co., Ltd, Beijing, China), and the total protein was measured using a Pierce BCA Protein Assay Kit (catalog 23225; Life Technologies).15,16 Hepatic steatosis and inflammation were evaluated according to the NAFLD activity score (NAS) system shown in Table S2.Proteins were photographed via a Chemi Doc MP system (Bio-Rad, Hercules, USA), and analyzed with ImageJ.The total protein concentration was measured using a BCA assay kit (Pierce Biotechnology, Inc., Rockford, IL, USA).Equivalent concentrations of samples were run on 10% SDS-PAGE gel and transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA).Proteins were photographeda Chemi Doc MP system (Bio-Rad, Hercules, USA), and analyzed with ImageJ.Hepatic tissues were collected for RNA extraction using Trizol, and reverse transcribed using a PrimeScript™ RT reagent Kit with a gDNA Eraser.qRT-PCR was performed using an SYBR Premix Ex Taq™ (TaKaRa, Tokyo, Japan) on an ABI one-step fast thermocycler (Applied Biosystems, Paisley, UK).With FFA treatment, the cells displayed an irregular or elliptic shape, and red lipid droplets were ubiquitously present in the cytoplasm, while the BPS treatment significantly decreased the red lipid droplets ( Fig.Moreover, knockdown of IL-22 significantly increased the red lipid droplets in FFA treated cells, and the IL-22 siRNA significantly blocked the restoration effect of BPS, as evidenced by the lipid increase in the FFA-IL-22si-BPS group, compared to the FFA-NC-BPS group ( Fig.Additionally, a significant accumulation of TG contents was observed in the NAFLD cells compared to those in the normal cells, while BPS significantly reduced the TG contents, and IL-22 deficiency completely abolished the BPS effect ( Fig.In addition, the NC group displayed a larger area of adipose cells than the normal group, while BP treatment significantly decreased the area of adipose cells (Table S3 HE staining suggested that the hepatic lobules of normal rats were complete and clear ( Fig.The central vein was large and thin, and was surrounded by liver cells, which were radially and orderly distributed.4 -induced liver disease via regulation of inflammation, oxidative stress, and stellate cell activation in mice.Bifidobacterium infantis , Lactobacillus acidophilus and Bacillus cereus suppress the progression of NAFLD via restoring the gut microbiota structure and reducing intestinal endotoxemia.Similar to our results, a previous study has shown that blueberries have a potential inhibitory effect on NAFLD at the early stage.14 Blueberry treatment alleviates CCl-induced liver diseaseregulation of inflammation, oxidative stress, and stellate cell activation in mice.15,16 Blueberry extracts attenuate γ-radiation-induced hepatocyte damageeffecting oxidative stress and suppressing NF-κB in rats.Consumption of bayberry juice can protect against NAFLD by improving the plasma antioxidant status and inhibiting the inflammatory and apoptotic responses in young adults.18 Jaboticaba berry peel induces higher production of gut SCFA, compounds known to counteract obesity markers, to prevent hepatic steatosis in mice fed a high-fat diet.19 Furthermore, several data exist to indicate that probiotics may be beneficial in the therapy of NAFLD,regulating the intestinal microbiota, improving the function of the epithelial barrier, improving intestinal inflammation, and reducing oxidative and inflammatory liver damage.20 For instance, probiotics containingandsuppress the progression of NAFLDrestoring the gut microbiota structure and reducing intestinal endotoxemia.21 Multi-probiotics (concentrated biomass of Bifidobacterium, Lactobacillus, Lactococcus, and Propionibacterium) reduce the fatty liver index, and cytokine and aminotransferase levels in NAFLD patients.In our previous study, we have reported that BP can reduce the damage to hepatocytes caused by the action of inflammatory cytokines, regulate lipid metabolism and reduce hepatocyte adipose degeneration 23 In this study, we show that blueberries mixed with probiotics reduce the formation of lipid droplets, improve lipid indicators, and improve the pathology of fatty liver, bothand, which further supports the alleviatory effect of BP on NAFLD.It has recently been shown that IL-22 mediates beneficial metabolic and anti-inflammatory effects in NAFLD patients.24 As a member of anti-inflammatory cytokines, IL-22 can act as a receptor in the JAK/STAT signaling pathway and reduce the TG synthesis related genes by activating the STAT3 pathway to improve fatty liver, caused by obesity.25 Kong et al. found that IL-22 can activate the JAK1/STAT3 signaling pathway through its receptor, IL-22RA1, and down-regulate the expression of FATP to improve lipid degeneration of hepatocytes.26 The STAT3 signaling pathway induces numerous genes involved in various biological processes, such as apoptosis, fat synthesis, and cell-cycle progression.Using the IL-22 siRNA, we found that IL-22 deficiency partly abolished the mitigation capacities of BP for NAFLD.The results of immunohistochemistry, immunofluorescence, qRT-PCR, and western blot showed that the IL-22 siRNA decreased the expression of JAK1 and STAT3, both in NAFLD cells and in the rat model under BP treatment, suggesting that BP induces IL-22 to activate the JAK1/STAT3 signaling pathway in NAFLD.Furthermore, the IL-22 siRNA increased the expression of BAX, both in NAFLD cells and in a rat model under BP treatment.Overall, these pieces of evidence suggest that BP mitigates NAFLD, partly by inhibiting the apoptosis of hepatocytes via the IL-22 mediated JAK1/STAT3/BAX signaling pathway.In conclusion, we have utilized detailed molecular approaches, and cell and rat models to demonstrate that the precise regulation of IL-22 in the liver is essential for the BP-mediated improvement of NAFLD.Moreover, BP might improve NAFLD partly through the inhibition of apoptosis via IL-22, mediating the JAK1/STAT3/BAX signaling pathway.This study further advances our understanding of the mechanisms underlying NAFLD, and can aid in the development of new therapeutic strategies., 2018157425–439 Q. Anstee, A. Mantovani, H. Tilg and G. Targher, Risk of cardiomyopathy and cardiac arrhythmias in patients with nonalcoholic fatty liver disease,, 2018157425–439 Search PubMed Innate Immun.Ten, TLR4-mediated pro-inflammatory dendritic cell differentiation in humans requires the combined action of MyD88 and TRIF,, 2014,(4), 423 CrossRef Aerobiologia , 2012, 33 (3), 1–11 S.

S. Iyer and G.

Cheng, Role of interleukin 10 transcriptional regulation in inflammation and autoimmune disease,, 2012,(3), 1–11 Search PubMed Hepatology , 2010, 52 (4), 1291 CAS PubMed.Park, M. Zheng, O.

Morales-Ibanez, J. K.

Kolls, R. Bataller and B. Gao, Interleukin-22 treatment ameliorates alcoholic liver injury in a murine model of chronic-binge ethanol feeding: Role of STAT3,, 2010,(4), 1291 CrossRef Ann., 2013, 12 (2), 256–262 V. W.

Wong, G. L.

Won, A. M.

Chim, W. C.

Chu, D. K.

Yeung, K. C.

Li and H. L.

Chan, Treatment of nonalcoholic steatohepatitis with probiotics.Y. Wang, M.

Cheng, B. Zhang, F.

Nie and H. Jiang, Dietary supplementation of blueberry juice enhances hepatic expression of metallothionein and attenuates liver fibrosis in rats,, 2013,(3), e58659 CrossRef World J.

Gastroenterol.Y. Wang, M. Cheng, B. Zhang, M. Mu and J. Wu, Effects of blueberry on hepatic fibrosis and transcription factor Nrf2 in rats,, 2010,(21), 2657–2663 CrossRef Drug Des., Dev.J.

Zhu, T. Ren, M. Zhou and M.

Cheng, The combination of blueberry juice and probiotics reduces apoptosis of alcoholic fatty liver of mice by affecting SIRT1 pathway,, 2016,, 1649–1661 CrossRef Food Res.M. Rossi, E.

Giussani, R. Morelli, S.

Rlo, R. C. Nani and D.

Torreggiani, Effect of fruit blanching on phenolics and radical scavenging activity of highbush blueberry juice,, 2003,(9), 999–1005 CrossRef Acta Agric.Jiangxi , 2012, 24 (1), 117–119 G. Q.

Wen, F. Nie and Y.

J. Liao, Comparative analysis of physicochemical component content in blueberry fruit and their function evaluation,, 2012,(1), 117–119 CAS Cell Res.Fan, RNF2 is recruited by WASH to ubiquitinate AMBRA1 leading to downregulation of autophagy,, 2014,(8), 943 CrossRef Vaccinium angustifolium ) consumption improves inflammatory status in the obese Zucker rat model of the metabolic syndrome, J.

Nutr.S. Vendrame, A. Daugherty, A. S.

Kristo, P. Riso and D.

Klimis-Zacas, Wild blueberry () consumption improves inflammatory status in the obese Zucker rat model of the metabolic syndrome,, 2013,(8), 1508–1512 CrossRef GMR, Genet.W. Zhan, X.

Liao, T. Tian, L.

Yu, X. Liu, B. Li, J. Liu, B. Han, R. J.

Xie, Q. H.

Ji and Q. Yang, Study on the effects of blueberry treatment on histone acetylation modification of CCl4-induced liver disease in rats,, 2017,(1) Food Chem.Sun, Y.

Wu, C. Long, P. He, J. Gu, L. Yang, Y. Liang and Y.

Wang, Anthocyanins isolated from blueberry ameliorates CCl4 induced liver fibrosis by modulation of oxidative stress, inflammation and stellate cell activation in mice,, 2018,, 491–499 CrossRef Saudi J. Biol.M.

I. Alkhaklaf and F. K.

Khalifa, Blueberry extract attenuates γ-radiation-induced hepatocyte damage by modulating oxidative stress and suppressing NF-κB in male rats,, 2018,(7), 1272–1277 CrossRef Nutrition , 2014, 30 (2), 198–203 CAS PubMed.H. Guo, R. Zhong, Y.

Liu, X. Jiang, X.

Tang, Z. Li, M. Xia and W. Ling, Effects of bayberry juice on inflammatory and apoptotic markers in young adults with features of non-alcoholic fatty liver disease,, 2014,(2), 198–203 CrossRef J.

Funct.Foods , 2018, 48 , 266–274 Â. G. Batista, J. K. da Silva-Maia, M. C.

P. Mendonça, E. S.

Soares, G. C.

Lima, S. Bogusz Junior, M. A. da Cruz-Höfling and M. R. Maróstica Júnior, Jaboticaba berry peel intake increases short chain fatty acids production and prevent hepatic steatosis in mice fed high-fat diet,, 2018,, 266–274 CrossRef World J.

Hepatol.S. M.

Ferolla, C. A. Couto and T.

C. A.

Ferrari, Probiotics as a complementary therapeutic approach in nonalcoholic fatty liver disease,, 2015,(3), 559–565 CrossRef Sci.He, N. Gao, X. Lu, M. Li, X. Wu, Z. Liu, Y.

Jin, J. Liu, J.

Xu and Y. Geng, Probiotics may delay the progression of nonalcoholic fatty liver disease by restoring the gut microbiota structure and improving intestinal endotoxemia,, 2017,, 45176 CrossRef J. Gastrointestin., 2018, 27 (1), 41–49 N. Kobyliak, L. Abenavoli, G. Mykhalchyshyn, L.

Kononenko, L. Boccuto, D.

Kyriienko and O. Dynnyk, A Multi-strain Probiotic Reduces the Fatty Liver Index, Cytokines and Aminotransferase levels in NAFLD Patients: Evidence from a Randomized Clinical Trial,, 2018,(1), 41–49 Search PubMed Nutrients , 2017, 9 (3), 198 PubMed.J.

, 2016, 1 (2), 93–100 A. Abdulla, C. Reynolds and H. A-Kader, Non-alcoholic fatty liver disease (NAFLD): The search for a cure,, 2016,(2), 93–100 CAS J. Hepatol.X. Kong, D.

Feng, S. Mathews and B. Gao, Hepatoprotective and anti-fibrotic functions of interleukin-22: therapeutic potential for the treatment of alcoholic liver disease,, 2013,(Supplement S1), 56–60 CrossRef Hepatology , 2004, 39 (5), 1332–1342 CAS PubMed.S. Radaeva, R.

Sun, H. N.

Pan, F. Hong and B.

Gao, Interleukin 22 (IL-22) plays a protective role in T cell-mediated murine hepatitis: IL-22 is a survival factor for hepatocytes via STAT3 activation,, 2004,(5), 1332–1342 CrossRef Inflammation Res.C. Pan, J. Tang, X. Wang, F. Wu, J. Ge and F.

Chen, Role of Interleukin-22 in liver diseases,, 2014,(7), 519–525 CrossRef Cell , 1993, 74 (4), 609–619 Z. N. Oltval, C. L. Milliman and S. J.

Korsmeyer, Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death,, 1993,(4), 609–619 CrossRef Int.Sun, S. Zhang, X. R. Li and W.

Wei, Targeted blockade of JAK/STAT3 signaling inhibits proliferation, migration and collagen production as well as inducing the apoptosis of hepatic stellate cells,, 2016,(3), 903–911 CrossRef Liver Int. .

Blueberry polyphenols play a preventive effect on alcoholic fatty liver

Recently, hepatocyte autophagy has been proved to play a protective effect in NAFLD and its complications by improving lipid accumulation and hepatic steatosis (8-10).Few pieces of literature reported that defective autophagy is also involved in the pathogenesis of AFLD, chronic ethanol-induced liver damage, and steatosis (11,12).Anthocyanins, one of the main ingredients of blueberry polyphenols, are beneficial for ameliorating the metabolic syndrome issues, such as obesity, hyperglycemia, hyperinsulinemia, and hyperlipidemia (18).A total of 60 male C57BL/6J of 4-week-old mice were bought from the Laboratory Animal Center of Shanghai Public Health Clinical College.All mice were raised for at least one week in a temperature-controlled room at 25 °C and 60% relative humidity with 12 hours’ light cycle and given free access to standard laboratory diet and water before experiments.The mice were treated and cared for according to the ethical guidelines of the National Institute of Health Guide and Use of Laboratory Animals of China.The arterial blood from the left ventriclewas collected and centrifuged to gain theserum for total cholesterol (CHOL) and triglyceride (TG) detection.Three hundred µL serum was taken out into Kuhlman AU480 blood biochemical analyzer to perform the CHOL and TG contents measurements by using kits (Hangzhou Yanchuang Bioengineering Institute, Zhejiang, China) according to manufacturer instructions.Lastly, an electronic microscope and the Olympus Image-Pro Plus 6.0 software were utilized for observation and quantitative analysis of ORO staining contents of TG.qRT-PCR was adopted to evaluate the mRNA expression level of lipogenesis-related genes such as sterol regulatory element-binding protein 1 (SREBP-1), fatty acid synthase (FAS), acetyl coenzyme A carboxylase (ACC) α (ACCα), and lipolysis-related genes such as adipose triglyceride lipase (ATGL) and sirtuin 1 (SIRT1) in mice liver tissues.Proteins were extracted from mice liver tissues (250 mg) and then treated with RIPA lysis buffer (Beyotime, Jiangsu, China) holding a 2% cocktail pill (Roche).Figure 1 The effect of blueberry polyphenols on blood lipid levels in alcoholic fatty liver disease C57BL/6J mice.ORO and HE staining revealed that chronic alcohol consumption led to hepatic steatosis with accumulated lipid droplets in the livers, whereas rare lipid droplets existed in livers in low-fat diet control mice or control mice treated with blueberry polyphenol.SREBP-1, sterol regulatory element binding protein 1; FAS, fatty acid synthase; ACCα, acetyl coenzyme A carboxylase; ATGL, adipose triglyceride lipase; SIRT1, sirtuin 1; PPE, purified blueberry polyphenol extract.WB identified that chronic drinking decreased or damaged the hepatocyte autophagy with higher level of p62 and lower specific value of LC3-II/LC3-I than in corresponding control mice (P<0.05 or P<0.01), however, compared with the control group, blueberry polyphenol added 100 or 200 mg/kg bw/day increased this autophagy with antipodal finds with model group (ethanol-fed added) with no statistical differences (P>0.05).In the current work, we initially demonstrated that the effects of blueberry polyphenols in AFLD and on hepatocyte autophagy: blueberry polyphenols alleviates AFLD in mice via promoting hepatocyte autophagy with declined p62 and increased LC3-II/LC3-I, then to decrease the serum lipid level with reductive TG and elevated CHOL contents in serum, as well as lower the hepatic steatosis conditions with lessened hepatic lipid droplets accumulation of TG, reduced lipogenic genes of SREBP1, FAS and ACCα, and accessorial lipodieretic genes of ATGL and Sirt1 in liver tissues.It can down-regulate PEPCK mRNA (a key-enzyme of the citric acid cycle (TCA), involved in hepatic energy metabolism and gluconeogenesis) in rat hepatoma cells (H4IIE), and the inhibition of PEPCK mRNA will lead to repressing gluconeogenesis and consequent blood glucose decline to play antidiabetic activity, and inhibit anabolic reactions to functions as tumor-suppressor (15,25-27).Thus, these reported conclusions were forcefully supported our finding that blueberry polyphenols improved the steatosis in the liver tissue induced by chronic alcohol intake.Despite some contradictions existed, the model is different, and the effect of attenuating the abnormally elevated lipid metabolism is consistent with Jiao et al.’s report.Besides, rare evidence supported that blueberry polyphenols can play potential protective roles on liver injuries such as hepatic steatosis and NAFLD (13,14), and it can ameliorate microvascular steatosis in hepatocytes and reduce adipose cell sizes via reducing the levels of the lipogenic gene of PPARγ, FAS, and SREBP-1 and significantly increasing the levels of the lipoclastic gene of CPT 1 and PPARα in liver tissue in HFD-induced obese C57BL/6J mice (16).Here, we first identified that blueberry polyphenols were beneficial to AFLD that improved the chronic ethanol intake-induced hepatic steatosis, elevated blood lipids and impaired hepatocyte autophagy in male C57BL/6J mice, and these preventive effects of blueberry polyphenols in AFLD appeared with a concentration gradient effect.Although the pathogenesis of AFLD is still very limited, a small number of reports demonstrated defective hepatocyte autophagy is a crucial pathogenesis of both NAFLD and AFLD, even the complications of them, that lead to lipid accumulation and hepatic steatosis, while up-regulation of autophagy can accelerate the fat elimination in liver then to prevent hepatocytes injuries such as steatosis and cell death (8-12).Here, we also proved that chronic alcohol consumption induced hepatic steatosis with accumulated lipid droplets and increased TG content in the livers compared with low-fat diet control mice, and these alterations induced by ethanol is associated with down-regulated autophagy (enhancive protein expression level of p62, and decreased protein ratio of LC3-II/LC3-I), increased lipogenic mRNA levels of SREBP1, FAS, and ACCα, and declined lipodieretic mRNAs of ATGL and Sirt1.In the study of Zhang et al., a spontaneous hepatic steatosis, presented as massive accumulation of lipid droplets with significant accessorial TG in hepatocytes, which was accompanied by upregulated lipid synthesis-associated proteins (primarily triglyceride synthesis) levels of ACCα, FAS and SREBP1 that might related to the autophagy dysfunction with upregulated P62 and reduced LC3BII/LC3BI ratio both in vitro (34), these findings are consistent with our outcomes.Hence, blueberry polyphenols resist AFLD may through facilitating hepatocytes autophagy to promote lipolysis and remove excessive TG accumulation in liver cells.The mechanism of blueberry polyphenols improving the hepatic steatosis in AFLD C57BL/6J mice may be associated with enhanced cell autophagy to accelerate the decomposition of fat than to eliminate excessive TG accumulation in hepatocytes.Funding: The present study was supported by a grant from the Key Project of Natural Science Foundation of Zhejiang Province (No.Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.The mice were treated and cared for according to the ethical guidelines of the National Institute of Health Guide and Use of Laboratory Animals of China.Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license).[Crossref] [PubMed] Zhong F, Hu Z, Jiang K, et al. Complement C3 activation regulates the production of tRNA-derived fragments Gly-tRFs and promotes alcohol-induced liver injury and steatosis.[Crossref] [PubMed] Wang Y, Zhao H, Li X, et al. Tangshen Formula Alleviates Hepatic Steatosis by Inducing Autophagy Through the AMPK/SIRT1 Pathway.[Crossref] [PubMed] Tang L, Yang F, Fang Z, et al.

Resveratrol Ameliorates Alcoholic Fatty Liver by Inducing Autophagy.[Crossref] [PubMed] Liu Y, Wang D, Zhang D, et al. Inhibitory effect of blueberry polyphenolic compounds on oleic acid-induced hepatic steatosis in vitro.[Crossref] [PubMed] Håkansson A, Bränning C, Molin G, et al. Blueberry husks and probiotics attenuate colorectal inflammation and oncogenesis, and liver injuries in rats exposed to cycling DSS-treatment.[Crossref] [PubMed] Hoskin RT, Xiong J, Esposito DA, et al. Blueberry polyphenol-protein food ingredients: The impact of spray drying on the in vitro antioxidant activity, anti-inflammatory markers, glucose metabolism and fibroblast migration.[Crossref] [PubMed] Jiao X, Wang Y, Lin Y, et al. Blueberry polyphenols extract as a potential prebiotic with anti-obesity effects on C57BL/6 J mice by modulating the gut microbiota.[Crossref] [PubMed] Jayaprakasam B, Olson LK, Schutzki RE, et al. Amelioration of obesity and glucose intolerance in high-fat-fed C57BL/6 mice by anthocyanins and ursolic acid in Cornelian cherry (Cornus mas).[Crossref] [PubMed] Zhang YH, Ma Q, Ding P, et al.

S100A4 Gene is Crucial for Methionine-Choline-Deficient Diet-Induced Non-Alcoholic Fatty Liver Disease in Mice.[Crossref] [PubMed] Lo Faro ML, Fox B, Whatmore JL, et al. Hydrogen sulfide and nitric oxide interactions in inflammation.[Crossref] [PubMed] Prasad S, Gupta S, Tyagi A.

Reactive oxygen species (ROS) and cancer: Role of antioxidative nutraceuticals.[Crossref] [PubMed] Correia R, Grace MH, Esposito D, et al. Wild blueberry polyphenol-protein food ingredients produced by three drying methods: Comparative physico-chemical properties, phytochemical content, and stability during storage.[Crossref] [PubMed] Welch C, Zhen J, Bassène E, et al. Bioactive polyphenols in kinkéliba tea (Combretum micranthum) and their glucose-lowering activities.[Crossref] [PubMed] Yan F, Dai G, Zheng X. Mulberry anthocyanin extract ameliorates insulin resistance by regulating PI3K/AKT pathway in HepG2 cells and db/db mice.[Crossref] [PubMed] Montal ED, Dewi R, Bhalla K, et al.

PEPCK coordinates the regulation of central carbon metabolism to promote cancer cell growth.[Crossref] [PubMed] Bjørkøy G, Lamark T, Brech A, et al. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death.Cite this article as: Zhuge Q, Zhang Y, Liu B, Wu M.

Blueberry polyphenols play a preventive effect on alcoholic fatty liver disease C57BL/6 J mice by promoting autophagy to accelerate lipolysis to eliminate excessive TG accumulation in hepatocytes. .

What Berry Is Best for Your Liver?

This is because tart fruit contains organic acids that are believed to help lower blood sugar levels, burn fat and cleanse the liver.Finnish researchers published a study in a 2010 edition of the European Journal of Clinical Nutrition that examined the health effects of berry consumption.They found that a daily diet rich in berries reduced the level of enzymes released from liver cells when they are damaged (alanine aminotransferase or ALT) by an astounding 23 percent.In addition, the test group that consumed an average of 163 grams of popular, locally harvested Scandinavian berries per day had lower levels of inflammation in their blood.Raspberry ketones are structurally similar to capsacin in red peppers, synephrine in citrus peel and zingerone in ginger extract – all of which have been shown to have health benefits.Although no human studies have yet confirmed these observations, raspberry ketones have emerged as a popular supplement to help minimize fat from accumulating in the liver.Antioxidants are vital in countering free radicals, the harmful byproducts of cellular metabolism that can contribute to cancer, atherosclerosis, liver damage and other age-related diseases.According to James Joseph, PhD, lead scientist in the Laboratory of Neuroscience at the USDA Human Nutrition Research Center on Aging at Tufts University, “When it comes to brain protection, there is nothing quite like blueberries.A Chinese study published in a 2010 edition of the World Journal of Gastroenterology examined the effects of blueberries on hepatic fibrosis – scarring of liver tissue.A University of Illinois laboratory study showed that various compounds in wild blueberries – including anthocyanins – possess the power to help prevent liver cancer in all three phases: initiation, promotion and proliferation.However, blueberries’ extremely high antioxidant content and scientific data on hepatic support makes them stand out as the top liver berry. .

7 Foods That Cleanse Your Liver

Are rich in cyanarin, chlorogenic acid, and other compounds that boost the liver’s detox pathways, protect against oxidative stress, and reduce the risk of liver damage.Try this: Steam whole artichokes and serve them with warm olive oil infused with rosemary and garlic; toss chopped artichoke hearts with cannellini beans, black olives, roasted red peppers, and baby arugula; quarter baby artichokes, grill until tender, and toss with a dressing of minced shallots, grapefruit juice, and olive oil.Studies show that drinking coffee lowers the risk of cirrhosis, a condition marked by scarring of the liver, even in people with chronic liver disease.Related: Coconut Oil Coffee.In one study, men with fatty liver disease who took broccoli sprout extract showed improved liver enzyme levels and decreased oxidative stress.It’s high in betalains and other compounds that have been shown to reduce inflammation, protect against oxidative stress, and reduce the risk of liver damage.Is high in catechins, antioxidants that improve blood markers of liver health, boost liver enzyme levels, and protect against oxidative stress and fat deposits in the liver.Try this: Cook brown rice and dried mushrooms in a broth of strong brewed green tea, tamari, and ginger; combine matcha green tea powder with minced garlic, ginger, sesame oil, and rice vinegar for a robust Asian dressing; purée cooled green tea with cucumbers, baby spinach, and honey for a refreshing beverage.Some studies suggest that blueberries, as well as cranberries, protect against liver damage and reduce the risk of fibrosis. .

Combined intake of blueberry juice and probiotics ameliorate

Briefly, blueberries (1 kg) were thawed at 4 °C for 8 h and then ground with a Braun Global Hand Mixer (MR 300; De 'Longhi Kenwood A. P.

A. Ltd., Hong Kong, China).The main components of the blueberry juice were constant, with 0.98 ± 0.07 mg/mL anthocyanin, consistent with our previous results [23].C57BL/6 J mice (half male/female, 6–8 weeks, 15–18 g) were purchased from the Animal Center of Guizhou Medical College [Approval No.Prior to F1258SP feeding, the model mice were pretreated via stomach injection of 31.5% ethanol solution (5 g solution/kg body weight).The sequence with the best blocking effect (GCAGGTTGCAGGAATCCAAAG) was packaged in a lentiviral plasmid using vector LV3 (H1/GFP and Puro) and Gemma Technology.AFLD mice received intra-articular injections of 100 μL lentiviral supernatants (1 × 108 viral particles) twice daily for 10 days.After 10 days of treatment with BP and SIRT1 siRNA, all mice were sacrificed, and liver tissues were collected.The mitochondrial was mixed with 1 mL swelling test solution, which contains 0.25 mol/L sucrose, 5 × 10−3 mol/L KH 2 PO 4 , 3 × 10−3 mol/L sodium, and 3 × 10−4 mol/L CaCl 2 .A larger ΔA value indicates a more robust mitochondrial buffering of calcium ions and better structural integrity.After 10 days of treatment with BP and SIRT1 siRNA, liver tissues were collected, washed with PBS, fixed with 4% paraformaldehyde, embedded in paraffin, cut into 4-μm sections, and stained with hematoxylin and eosin.On day 12, liver tissues were removed from the − 80 °C freezer to detect the mitochondrial respiratory function.The respiratory rate was detected using the Clark Oxygen Electrode technique in a 3-mL volume at pH 7.35–7.45 with 0.01 mol/L KCl, 5 mmol/L MgCl 2 , 0.2 mol/L succinic acid, 0.Cells were collected and incubated with the fluorescent probe DCFH-DA for 30 min, then washed three times with PBS.Liver tissues were washed 3 times with PBS, immersed in 4% formaldehyde fixation for 3 h. The tissues were dehydrated in 30% sucrose, embedded in an optimal cutting temperature mixture (Sakura Finetek Co., Ltd, Tokyo, Japan), frozen on dry ice, and then cut into 6-μm thick sections.Total protein in liver tissues, removed from the − 80 °C freezer at day 12, was extracted, and concentrations was determined via a BCA assay kit (Pierce Biotech, Inc., Rockford, USA).Total protein (30 µg) was separated by 10% SDS-PAGE gel and transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA).Hepatocytes in AFLD mice were swollen, the nuclear membrane were destroyed, and most damaged organelles appeared damaged, including the mitochondria, which showed a fragmentary and dissolved mitochondrial membrane, with virtually no mitochondrial cristae visible.Hepatic necrosis was apparent in AFLD mice versus normal controls, but BP reduced the necrotic area and swelling to near-normal levels (Fig.Notably, succinate dehydrogenase (SDH) and cytochrome c oxidase (CCO), indexes of hepatic mitochondrial function, were significantly increased with BP treatment of AFLD mice relative to normal mice, and SIRT1 abrogated this effect (Fig.B Hepatic mitochondrial respiratory function is expressed as state 4 and 3 respiration rates, RCR, and the ADP/O ratio.Lowercase letters (a, b, c, and d) represent significant differences (*P < 0.05, Student’s t-test, n = 8) Full size image.Knockdown of SIRT1 attenuated the decreasing mitochondrial oxidative stress in AFLD mice with BP treatment.Oxidative stress, characterized by the characteristic of ROS, increasing malondialdehyde (MDA), and the inhibition of antioxidant enzymes such as superoxide dismutase (SOD) and glutathione (GSH) [26,27,28], is closely linked to mitochondrial function.SIRT1 silencing, however, abolished the effect of BP on mitochondrial oxidative stress in AFLD mice.3 Knockdown of SIRT1 attenuated the decreasing mitochondrial oxidative stress in AFLD mice with BP treatment.Lowercase letters (a, b, c, and d) represent significant differences (*P < 0.05, Student’s t-test, n = 8) Full size image.Interestingly, the SIRT1 expression was elevated in AFLD mice treated with BP, and this effect was reversed by siRNA silencing.B Immunohistochemical analysis was performed to evaluate the expression of SIRT1 in mouse livers of different groups (Scale bar: 80 μm).Lowercase letters (a, b, c, and d) represent significant differences (*P < 0.05, Student’s t-test, n = 8) Full size image.We next sought to understand why SIRT1 knockdown eliminates BP protection of mitochondrial function in AFLD mice.Previous studies have shown that PGC-1α cytokine lies downstream of SIRT1, which is mainly expressed in mitochondria-rich tissues [30]. .

Blueberry: A Liver-Friendly Food

The liver performs variety of essential tasks – ranging from producing proteins, cholesterol and bile to storing vitamins, minerals and even carbohydrates.The liver is one of the most important organs in the body, performing fundamental role in the regulation of diverse processes.Both are storehouse of health benefits and can increase your immune cell response and antioxidant enzymes.What’s more, blueberry extract has even been shown to inhibit the growth of human liver cancer cells in test-tube studies. .

Share

Related

Are Blueberry Banana Smoothies Good For You

Are Blueberry Banana Smoothies Good For You.

This is our go-to blueberry smoothie recipe!It is made with frozen fruit, almond milk, flax meal, and a little bit of vanilla.Favorite Blueberry Smoothie Recipe.This blueberry smoothie recipe is a personal favorite of mine because it’s naturally sweetened with frozen bananas and perfectly thick.Frozen blueberries: the basis of this smoothie is frozen blueberries!If you want to use fresh blueberries, we recommend adding in some ice so that it stays thick.Frozen vs.

Is It Bad To Eat Blueberries At Night

Is It Bad To Eat Blueberries At Night.

Cyanococcus) is a flowering shrub that produces berries with a bluish, purple hue — also known as blueberries.It is closely related to similar shrubs, such as those that produce cranberries and huckleberries.Blueberries are small — around 0.2–0.6 inches (5–16 millimeters) in diameter — and feature a flared crown at the end.Lowbush or “wild” blueberries: Typically smaller and richer in some antioxidants.

Are Cherries A Good Fruit For Diabetics

Are Cherries A Good Fruit For Diabetics.

When you're looking for a diabetes-friendly treat that can help keep your blood sugar within a healthy range, look no farther than the produce drawer of your refrigerator or the fruit basket on your kitchen table.Believe it or not, the notion that fruit is not safe when you need to watch your A1C is a popular diabetes myth that has been debunked again and again.Indeed, according to the American Diabetes Association (ADA), many types of fruit are loaded with good-for-you vitamins and minerals, as well as fiber — a powerful nutrient that can help regulate blood sugar levels and decrease your risk of developing type 2 diabetes, according to the Harvard T.H.